Isolation and characterization of promoter sequence of ZNF703 gene and related transcription factors via genomeinformatics analysis
عنوان مقاله: Isolation and characterization of promoter sequence of ZNF703 gene and related transcription factors via genomeinformatics analysis
شناسه ملی مقاله: ICBCMED11_075
منتشر شده در یازدهمین کنگره بین المللی سرطان پستان در سال 1394
شناسه ملی مقاله: ICBCMED11_075
منتشر شده در یازدهمین کنگره بین المللی سرطان پستان در سال 1394
مشخصات نویسندگان مقاله:
Somaye Ghanaat doust - Department of biotechnology…، Urmia Branch، Islamic Azad University، Urmia،Iran
خلاصه مقاله:
Somaye Ghanaat doust - Department of biotechnology…، Urmia Branch، Islamic Azad University، Urmia،Iran
Somaye.Ghanaat doust: Department of biotechnology…، Urmia Branch، Islamic Azad University، Urmia،Iran Introduction: Znf703 gene is the producer of zinc finger protein and located on human chromosome 8. ZNF703 gene s role in breast cancer progression and metastasis in a mouse cancer cell line has been identified. In these cellshigh expression of ZNF703 suppress the expression of E-Cadherin.due the proliferation and invasion of breast cancer cells will be increase. Method: Download the complete sequence of znf703 gene from ncbi database then selected 751 nocleotide from upstream of the gene as a potential area.the selected area was under scrutiny with consite and Promoter Prediction by Neural Network data bases. regulatory elements were identified Results was approved by easynn-plus application based on artificial intelligence. Results: Based on the Promoter Prediction by Neural Network database resulte sequences 37695578 to 37695628 were detected as promoter Start End Score Promoter Sequence 578 628 0.86 CGGGAGCGGCCGAGACCGAGGCAGCGGCGGCGCGCGGCGCGGCCCCTTTA Some transcription factors identified in the consite database is as the below: NF-Y,Myf,CFI-USP,Bsap,CREB,TBP,SRF,AGL3,E74A,NF-KappaB,P50,COUPTF, C-REL,Dorsal2,AML-1,Thing1-E47,SOX17,Bzip410,HFH- 3,USF,ARNT,SPZ1,RREB-1,chop-Cebp,BSap,FREAC-4,n-Myc,Snail Discussion and conclusion Given that no such study has been done about the identification of znf703 geneʼs promoter. for the first time, This study has been able to effectively identify the area. It can be said with certainty that the desired area is containing the gene znf703 promoter.
کلمات کلیدی: breast cancer ,znf703 gene,prompter
صفحه اختصاصی مقاله و دریافت فایل کامل: https://civilica.com/doc/726735/