Publisher of Iranian Journals and Conference Proceedings

Please waite ..
CIVILICAWe Respect the Science
Publisher of Iranian Journals and Conference Proceedings
عنوان
Paper

The similar miRNAs have different missions in the dissimilar plant tissues

تعداد صفحات: 1 | تعداد نمایش خلاصه: 116 | نظرات: 0
سال انتشار: 1397
کد COI Paper: IBIS08_080
زبان Paper: Englishglish
نسخه کامل Paper در کنفرانس ارائه نشده است و در دسترس نیست.

مشخصات نویسندگان Paper The similar miRNAs have different missions in the dissimilar plant tissues

بهنام بخشی - 1بخش تحقیقات زراعی و باغی، مرکز تحقیقات و آموزش کشاورزی و منابع طبیعی سیستان، سازمان تحقیقات، آموزش و ترویج کشاورزی، زابل، ایران
احسان محسنی فرد - 2گروه زراعت و اصلاح نباتات، دانشکده کشاورزی، دانشگاه زنجان، زنجان
قاسم حسینی سالکده - 3گروه زیست شناسی سامانه ها، پژوهشگاه بیوتکنولوژی کشاورزی ایران، سازمان تحقیقات، آموزش و ترویج کشاورزی، کرج، ایران
محمدرضا بی همتا - 4گروه اصلاح نباتات، پردیس کشاورزی و منابع طبیعی دانشگاه تهران، کرج، ایران

چکیده Paper:

Evaluation of miRNAs Expression pattern in the different plant tissues was the purpose of the current study. To this end, we have used IR64, a rice variety, as a model. Small RNA extracted from shoot and root tissues of plant and high throughput deep sequencing was applied to compare expression pattern of miRNAs in the different tissues. Results revealed 344 and 374 precursor and mature miRNAs in shoot and 326 and 353 precursor and mature miRNAs in root tissues, respectively. TCGCTTGGTGCAGATCGGGAC was the frequent miRNA sequence in both tissues named miR168a. In this study there were some mature miRNAs that only expressed in one of the tissues. Furthermore, many of miRNAs have been expressed differentially in a tissue compared to other tissue. Our results indicated that miRNAs play essential roles in dissimilar tissues but their regulation were distinct in the different tissues. Target prediction and gene ontology analysis showed that genes that are regulated by these miRNAs are involved in plant organs growth and development. Therefore, results of high throughput deep sequencing revealed that although miRNAs could be ubiquitous but with their differentially expression in the different tissues could alter their specific roles.

کلیدواژه ها:

microRNA, Expression profiling, Next generation sequencing, Gene ontology, Target prediction

کد Paper/لینک ثابت به این Paper

برای لینک دهی به این Paper می توانید از لینک زیر استفاده نمایید. این لینک همیشه ثابت است و به عنوان سند ثبت Paper در مرجع سیویلیکا مورد استفاده قرار میگیرد:

https://civilica.com/doc/908743/

کد COI Paper: IBIS08_080

نحوه استناد به Paper:

در صورتی که می خواهید در اثر پژوهشی خود به این Paper ارجاع دهید، به سادگی می توانید از عبارت زیر در بخش منابع و مراجع استفاده نمایید:
undefined, undefined و undefined, undefined و undefined, undefined و undefined, undefined,1397,The similar miRNAs have different missions in the dissimilar plant tissues,هشتمین همایش بیوانفورماتیک ایران,Zabol,,,https://civilica.com/doc/908743

در داخل متن نیز هر جا که به عبارت و یا دستاوردی از این Paper اشاره شود پس از ذکر مطلب، در داخل پارانتز، مشخصات زیر نوشته می شود.
برای بار اول: (1397, بخشی, بهنام؛ احسان محسنی فرد و قاسم حسینی سالکده و محمدرضا بی همتا)
برای بار دوم به بعد: (1397, بخشی؛ محسنی فرد و حسینی سالکده و بی همتا)
برای آشنایی کامل با نحوه مرجع نویسی لطفا بخش راهنمای سیویلیکا (مرجع دهی) را ملاحظه نمایید.

Research Info Management

Certificate | Report Paper

Export Citation info of this Paper to research management softwares

علم سنجی و رتبه بندی Paper

مشخصات مرکز تولید کننده این Paper به صورت زیر است:
نوع مرکز: سازمان تحقیقات کشاورزی
تعداد مقالات: 190
در بخش علم سنجی پایگاه سیویلیکا می توانید رتبه بندی علمی مراکز دانشگاهی و پژوهشی کشور را بر اساس آمار مقالات نمایه شده مشاهده نمایید.

New RelatedPapers

Share this paper

WHAT IS COI?

COI is a national code dedicated to all Iranian Conference and Journal Papers. the COI of each paper can be verified online.

Support