An Investigation of Promoter-Targeted Small Activating RNAs On BMP2 Up-regulation

Publish Year: 1397
نوع سند: مقاله کنفرانسی
زبان: English
View: 442

نسخه کامل این Paper ارائه نشده است و در دسترس نمی باشد

  • Certificate
  • من نویسنده این مقاله هستم

استخراج به نرم افزارهای پژوهشی:

لینک ثابت به این Paper:

شناسه ملی سند علمی:

NSCMRMED03_356

تاریخ نمایه سازی: 30 دی 1397

Abstract:

Background and Aim: saRNAs (Small activating RNAs) are smalldouble-stranded RNAs (dsRNAs) that target gene promoters to inducetranscriptional gene activation in a process known as RNA activation(RNAa). In this study, we are going to investigate the likelihood to enhancethe BMP2 expression in human Mesenchymal Stem Cells (hMSCs) usingspecifically designed saRNAs. If so, we can use the designed saRNAs asaffordable small osteogenic factors in synthetic bone grafts and substitutematerials instead of expensive BMP2 proteins with side effects.Methods: First, two different dsRNAs targeting BMP2 promoter aredesigned using short hairpin RNA target design tools including DSIRand Dharmacon. Secondly, the dsRNA inserts are separately ligatedinto the pCDH vector and then transformed using heat shock in homemadecompetent cells. In the following, target cells will be individuallytransfected with two kinds of constructs expressing BMP2 promotertargetedsaRNAs with the backbone construct serving as negative control.Using qRT-PCR, the relative expression of BMP2 and other marker genesin osteogenesis are measured at the mRNA level in both treated andcontrol cellsResults: Using target design tools we chose GAATATATTTATAGAAATATA and CTGCATTTGTCCTGGATTTCG sequences as the potent saRNAs toactivate BMP2 gene expression. The sequences were successfully cloned.Following target cell transfection, the results show that our designedosteogenic dsRNAs could affect osteogenic pathway through targetingthe BMP2 promoter. Based on the literature survey and saRNA targetdesign tools, we believe our designed saRNAs hold a high potential toinduce osteogenesis. Such a finding may have a great impact on genetherapy of bone associated disease, which would obviate the need forcloning of the large BMP gene by using a short RNA sequence insteadConclusion: Our finding will provide a novel approach to up-regulatethe desired genes in different cells. However, the cell-type dependencyof RNAa makes it tough to make a common algorithm for designingsaRNAs. In addition, promoters consisting of certain elements such asthe TATA box and CGIs (CpG islands) appeared to be more potent to beaffected by dsRNAs

Keywords:

Authors

Zahra Shojaei Jeshvaghani

Department of Biotechnology, College of Science, University of Tehran, Tehran, Iran

Mahboubeh Kabiri

Department of Molecular Biology and Genetic Engineering, Stem Cell Technology Research Center, Tehran, Iran

Fatemeh Koukhan

Department of Molecular Biology and Genetic Engineering, Stem Cell Technology Research Center, Tehran, Iran

Masoud Soleimani

Hematology and Cell Therapy Department, Tarbiat Modares University, Tehran, Iran