Inhibitory effect of twist۱ antisense oligo-nucleotides on invasion rate of androgen dependent prostatic cancer cells
Publish place: International Conference on Human Genetics and Genomics
Publish Year: 1400
نوع سند: مقاله کنفرانسی
زبان: English
View: 131
نسخه کامل این Paper ارائه نشده است و در دسترس نمی باشد
- Certificate
- من نویسنده این مقاله هستم
این Paper در بخشهای موضوعی زیر دسته بندی شده است:
استخراج به نرم افزارهای پژوهشی:
شناسه ملی سند علمی:
CHGGE01_180
تاریخ نمایه سازی: 13 مهر 1401
Abstract:
Backgrounds: The movement of malignant cells to other tissues during metastasis is the mostimportant cause of non-effective response to treatment in patients suffering prostate cancer.Preventing metastasis can be done by targeting effective factors as twist۱, a helix-loop-helixprotein stimulating EMT. In this research, we studied the inhibitory effect of two designedantisense oligonucleotides on early metastatic LNCaP cell lines.Materials and Methods: Androgen-dependent metastatic LNCaP cell line was used as a model.Evaluating of cell invasion was done by CytoSelect™ ۱۲-Well Cell Invasion Assay Kit (CellBiolabs). For achieving this, ۰.۷۵*۱۰۶ LNCaP cells in FBS free RPMI medium (۳۰۰ μl) wereused. In this case, an RPMI culturing medium containing ۱۰ % FBS with a final volume of ۵۰۰μl was used as a chemoattractant mediator. Readily designed ۲ antisense oligonucleotides weredistinctly used as invasion inhibitors. The concentration of ۵۰۰ nmol was selected for antisenseoligonucleotides according to results was obtained from the MTT assay. Incubation was done for۴۸ hours in a cell culture incubator at ۳۷o C and ۵% CO۲ atmosphere. Invasive cells werestained lastly and results were observed by measurement of OD۵۶۰ in a microplate reader(BioTek).Results: an anti-invasive effect of ۳۷ and ۳۱.۴ % were observed respectively for antisenseoligonucleotide ۱(۵' GTCCTGCATCATCTCTCGAG ۳') and antisense oligonucleotide ۲ (۵'CACGTCCTGCATCATCTCTC ۳') in the LNCaP cell line.Conclusion: ex vivo results obtained from this study, were revealed that down-regulation oftwist۱ gene can act as metastasis rate limiter in the non-progressed metastatic prostate cancer cellline. Therefore, it can be used as a proper candidate for combinatorial therapy in patients withandrogen-dependent prostate cancer.
Keywords:
Authors
Nahid Bakhtiari
Biotechnology department, Iranian Research Organization for Science and Technology (IROST), Tehran, Iran
Sohameh Mohebbi
Department of Biotechnology, Faculty of science, Ale-Taha institute of Higher Education, Tehran, Iran